Read Online Free Book

Jurassic Park

Page 8

    Tim shook his head. He didn't understand what Grant was talking about. "My mom said it was just a resort, you know, with swimming and tennis."

    "Not exactly," Grant said. "I'll explain as we walk along."

    Now I'm a damned babysitter, Ed Regis thought unhappily, tapping his foot as he waited in the visitor center. That was what the old man had told him him: You watch my kids like a hawk, they're your responsibility for the weekend.

    Ed Regis didn't like it at all. He felt degraded. He wasn't a damn babysitter. And, for that matter, he wasn't a damned tour guide, even for VIPs. He was the head of public relations for Jurassic Park, and he had much to prepare between now and the opening, a year away. Just to coordinate with the PR firms in San Francisco and London, and the agencies in New York and Tokyo, was a full-time job-especially since the agencies couldn't yet be told what the resort's real attraction was. The firms were all designing teaser campaigns, nothing specific, and they were unhappy. Creative people needed nurturing. They needed encouragement to do their best work. He couldn't waste his time taking scientists on tours.

    But that was the trouble with a career in public relations-nobody saw you as a professional. Regis had been down here on the island off and on for the past seven months, and they were still pushing odd jobs on him. Like that episode back in January. Harding should have handled that. Harding, or Owens, the general contractor. Instead, it had fallen to Ed Regis. What did he know about taking care of some sick workman? And now he was a damn tour guide and babysitter. He turned back and counted the heads. Still one short.

    Then, in the back, he saw Dr. Sattler emerge from the bathroom. "All right, folks, let's begin our tour on the second floor."

    Tim went with the others, following Mr. Regis up the black suspended staircase to the second floor of the building. They passed a sign that read:

    CLOSED AREA

    AUTHORIZED PERSONNEL ONLY

    BEYOND THIS POINT

    Tim felt a thrill when he saw that sign. They walked down the secondfloor hallway. One wall was glass, looking out onto a balcony with palm trees in the light mist. On the other wall were stenciled doors, like offices: PARK WARDEN ... GUEST SERVICES ... GENERAL MANAGER. . . .

    Halfway down the corridor they came to a glass partition marked with another sign:

    [picture]

    Underneath were more signs:

    CAUTION

    Teratogenic Substances

    Pregnant Women Avoid Exposure

    To This Area

    DANGER

    Radioactive Isotopes In Use

    Carcinogenic Potential

    Tim grew more excited all the time. Teratogenic substances! Things that made monsters! It gave him a thrill, and he was disappointed to hear Ed Regis say, "Never mind the signs, they're just up for legal reasons. I can assure you everything is perfectly safe." He led them through the door. There was a guard on the other side. Ed Regis turned to the group.

    "You may have noticed that we have a minimum of personnel on the island. We can run this resort with a total of twenty people. Of course, we'll have more when we have guests here, but at the moment there's only twenty. Here's our control room. The entire park is controlled from here."

    They paused before windows and peered into a darkened room that looked like a small version of Mission Control. There was a vertical glass see-through map of the park, and facing it a bank of glowing computer consoles- Some of the screens displayed data, but most of them showed video images from around the park. There were just two people inside, standing and talking.

    "The man on the left is our chief engineer, John Arnold"-Regis pointed to a thin man in a button-down short-sleeve shirt and tie, smoking a cigarette-"and next to him, our park warden, Mr. Robert Muldoon, the famous white bunter from Nairobi." Muldoon was a burly man in khaki, sunglasses dangling from his shirt pockct. He glanced out at the group, gave a brief nod, and turned back to the computer screens. "I'm sure you want to see this room," Ed Regis said, "but first, let's see how we obtain dinosaur DNA."

    The sign on the door said EXTRACTIONS and, like all the doors in the laboratory building, it opened with a security card. Ed Regis slipped the card in the slot; the light blinked; and the door opened.

    Inside, Tim saw a small room bathed in green light. Four technicians in lab coats were peering into double-barreled stereo microscopes, or looking at images on high resolution video screens. The room was filled with yellow stones. The stones were in glass shelves; in cardboard boxes; in large pull-out trays. Each stone was tagged and numbered in black ink.

     Regis introduced Henry Wu, a slender man in his thirties. "Dr. Wu is our chief geneticist. I'll let him explain what we do here."

    Henry Wu smiled. "At least I'll try," he said. "Genetics is a bit complicated. But you're probably wondering where our dinosaur DNA comes from."

    "It crossed my mind," Grant said.

    "As a matter of fact," Wu said, "there are two possible sources. Using the Loy antibody extraction technique, we can sometimes get DNA directly from dinosaur bones."

    "What kind of a yield?" Grant asked.

    "Well, most soluble protein is leached out during fossilization, but twenty percent of the proteins are still recoverable by grinding up the bones and using Loy's procedure. Dr. Loy himself has used it to obtain proteins from extinct Australian marsupials, as well as blood cells from ancient human remains. His technique is so refined it can work with a mere fifty nanograms of material. That's fifty-billionths of a gram."

    "And you've adapted his technique here?" Grant asked.
    "Only as a backup," Wu said. "As you can imagine, a twenty percent yield is insufficient for our work. We need the entire dinosaur DNA strand in order to clone. And we get it here." He held up one of the yellow stones. "From amber-the fossilized resin of prehistoric tree sap."

    Grant looked at Ellie, then at Malcolm.

    "That's really quite clever," Malcolm said, nodding.

    "I still don't understand," Grant admitted.

    "Tree sap," Wu explained, "often flows over insects and traps them. The insects are then perfectly preserved within the fossil. One finds all kinds of insects in amber-including biting insects that have sucked blood from larger animals."

    "Sucked the blood," Grant repeated. His mouth fell open. "You mean sucked the blood of dinosaurs.

    "Hopefully, yes."

    "And then the insects are preserved in amber. . . ." Grant shook his head. "I'll be damned-that just might work."

    "I assure you, it does work," Wu said. He moved to one of the microscopes, where a technician positioned a piece of amber containing a fly under the microscope. On the video monitor, they watched as he inserted a long needle through the amber, into the thorax of the prehistoric fly.

    "If this insect has any foreign blood cells, we may be able to extract them, and obtain paleo-DNA, the DNA of an extinct creature. We won't know for sure, of course, until we extract whatever is in there, replicate it, and test it. That is what we have been doing for five years now. It has been a long, slow process-but it has paid off.

    "Actually, dinosaur DNA is somewhat easier to extract by this process than mammalian DNA. The reason is that mammalian red cells have no nuclei, and thus no DNA in their red cells. To clone a mammal, you must find a white cell, which is much rarer than red cells. But dinosaurs had nucleated red cells, as do modern birds. It is one of the many indications we have that dinosaurs aren't really reptiles at all. They are big leathery birds."

    Tim saw that Dr. Grant still looked skeptical, and Dennis Nedry, the messy fat man, appeared completely uninterested, as if he knew it all already. Nedry kept looking impatiently toward the next room.

    "I see Mr. Nedry has spotted the next phase of our work," Wu said. "How we identify the DNA we have extracted. For that, we use powerful computers."

    They went through sliding doors into a chilled room. There was a loud humming sound. Two six-foot-tall round towers stood in the center of the room, and along the walls were rows of waist-high stainless-steel boxes. "This is our high-tech laundromat," Dr. Wu said. "The boxes along the walls are all Hamachi-Hood automated gene sequencers. They are being run, at very high speed, by the Cray XMP supercomputers, which are the towers in the center of the room. In essence, you are standing in the middle of an incredibly powerful genetics factory."

    There were several monitors, all running so fast it was hard to see what they were showing. Wu pushed a button and slowed one image.

    1    GCGTTGCTGG  CGTTTTTCCA  TAGGCTCCGC  CCCCCTGACG  AGCATCACAA  AAATCGACGC

    61    GGTGGCGAAA  CCCGACAGGA  CTATAAAGAT  ACCAGGCGTT  TCCCCCTGGA  AGCTCCCTCG

    121   TGTTCCGACC  CTGCCGCTTA  CCGGATACCT  GTCCGCCTTT  CTCCCTTCGG  GAAGCCTGGC

    181   TGCTCACGCT  GTAGGTATCT  CAGTTCGGTG  TAGGTCGTTC  GCTCCAAGCT  GGGCTGTGTG

    241   CCGTTCAGCC  CGACCGCTGC  GCCTTATCCG  GTAACTATCG  TCTTGAGTCC  AACCCGGTAA

    301   AGTAGGACAG  GTGCCGGCAG  CGCTCTGGGT  CATTTTCGGC  GAGAACCGCT  TTCGCTGGAG

    361   ATCGGCCTGT  CGCTTGCGGT  ATTCGGAATC  TTGCACGCCC  TCGCTCAAGC  CTTCGTCACT

    421   CCAAACGTTT  CGGCGAGAAG  CAGGCCATTA  TCGCCGGCAT  GGCGGCCGAC  GCGCTGGGCT

    481   GGCGTTCGCG  ACGCGAGGCT  GGATGGCCTT  CCCCATTATG  ATTCTTCTCG  CTTCCGGCGG

    541   CCCGCGTTGC  AGGCCATGCT  GTCCAGGCAG  GTAGATGACG  ACCATCAGGG  ACAGCTTCAA

    601   CGGCTCTTAC  CAGCCTAACT  TCGATCACTG  GACCGCTGAT  CGTCACGGCG  ATTTATGCCG

    661   CACATGGACG  CGTTGCTGGC  GTTTTTCCAT  AGGCTCCGCC  CCCCTGACGA  GCATCACAAA

    721   CAAGTCAGAG  GTGGCGAAAC  CCGACAGGAC  TATAAAGATA  CCAGGCGTTT  CCCCCTGGAA

    781   GCGCTCTCCT  GTTCCGACCC  TGCCGCTTAC  CGGATACCTG  TCCGCCTTTC  TCCCTTCGGG

    841   CTTTCTCAAT  GCTCACGCTG  TAGGTATCTC  AGTTCGGTGT  AGGTCGTTCG  CTCCAAGCTG

    901   ACGAACCCCC  CGTTCAGCCC  GACCGCTGCG  CCTTATCCGG  TAACTATCGT  CTTGAGTCCA

    961   ACACGACTTA  ACGGGTTGGC  ATGGATTGTA  GGCGCCGCCC  TATACCTTGT  CTGCCTCCCC

    1021  GCGGTGCATG  GAGCCGGGCC  ACCTCGACCT  GAATGGAAGC  CGGCGGCACC  TCGCTAACGG

    1081  CCAAGAATTG  GAGCCAATCA  ATTCTTGCGG  AGAACTGTGA  ATGCGCAAAC  CAACCCTTGG

    1141  CCATCGCGTC  CGCCATCTCC  AGCAGCCGCA  CGCGGCGCAT  CTCGGGCAGC  GTTGGGTCCT

    1201  GCGCATGATC  GTGCT.............     CCTGTCGTTG  AGGACCCGGC  TAGGCTGGCG  GGGTTGCCTT

    1281  AGAATGAATC  ACCGATACGC  GAGCGAACGT  GAAGCGACTG  CTGCTGCAAA  ACGTCTGCGA

    1341  AACATGAATG  GTCTTCGGTT  TCCGTGTTTC  GTAAAGTCTG  GAAACGCGGA  AGTCAGCGCC

    "Here you see the actual structure of a small fragment of dinosaur DNA," Wu said. "Notice the sequence is made up of four basic compounds-adenine, thymine, guanine, and cytosine. This amount of DNA probably contains instructions to make a single protein-say, a hormone or an enzyme. The full DNA molecule contains three billion of these bases. If we looked at a screen like this once a second, for eight hours a day, it'd still take more than two years to look at the entire DNA strand. It's that big."

    He pointed to the image. "This is a typical example, because you see the DNA has an error, down here in line 1201. Much of the DNA we extract is fragmented or incomplete. So the first thing we have to do is repair it-or rather, the computer has to. It'll cut the DNA, using what are called restriction enzymes. The computer will select a variety of enzymes that might do the job."

    1    GCGTTGCTGGCGTTTTTCCATAGGGTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC

    61    GGTGGCGAAACCCGACAGGACTFITAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG

    NspO4

    121   TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC

    181   TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCASGCTGGGCTGTGTG

    BrontIV

    241   CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA

    301   AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG

    434 DnxTl               AoliBn

    361   ATCGGCCTGTCGCTTGCGGTATTCGCAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT

    421   CCAAACGTTTCGGCGAGAAGCAGGCCATAATCGCCGGCATGGCGGCCGACGCGCTGGGCT

    481   GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG

    541   CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGHCCATCAGGGACAGCTTCAA

    601   CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG

    Nsp04

    661   CACATGGACCCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA

    721   CAAGTCAGAGGTGGCGAAACCCOACAGOACTATAAAGATACCAOOCOTTTCCCCCTGGAA

    924 Caoll I        DinoLdn

    781   GCGCTCTCCTOTTCCOACCCTOCCOCTTACCOGATACCTOTCCOCCTTTCTCCCTTCGGG

    841   CTTTCTCAATOCTCACOCTGTABGTATCTCAGTTCGGTOTAGGTCGTTCOCTCCAAOCTO

    901   ACGAACCCCCCOTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAOTCCA

    961   ACACOACTTAACCOOTTOOCATGGATTGTAGGCGCCGCCCTATACCTTGTCTOCCTCCCC

    1021  GCGGTGCATGOAOCCOGOCCACCTCGACCTGAATOGAAGCCGOCGOCACCTCOCTAACOG

    1081  CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG

    1141  CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT

    1416 DnxTI


    SSpd4

    1201  GCGCATGATCGTGCT:+=:CCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACT

    1281  ATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCT

    "Here is the same section of DNA, with the points of the restriction enzymes located. As you can see in line 1201, two enzymes will cut on either side of the damaged point. Ordinarily we let the computers decide which to use. But we also need to know what base pairs we should insert to repair the injury. For that, we have to align various cut fragments, like so."

    [picture]

    "Now we are finding a fragment of DNA that overlaps the injury area, and will tell us what is missing. And you can see we can find it, and go ahead and make the repair. The dark bars you see arc restriction fragments-small sections of dinosaur DNA, broken by enzymes and then analyzed. The computer is now recombining them, by searching for overlapping sections of code. It's a little bit like putting a puzzle together. The computer can do it very rapidly."

    1    GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC

    61    GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG

    121   TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCCTGGC

    181   TGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG

    241   CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA

    301   AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGAACCGCTTTCGCTGGAG

    361   ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT

    421   CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT

    481   GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG

    541   CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA

    601   CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG

    661   CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA

    721   CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATA  CCAGGCGTTTCCCCCTGGAA

    781   GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG

    841   CTTTCTCAATGCTCACGCTGTAGGTATCTC     AGTTCGGTGTAGGTCGTTCGCTCCAAGCTG

    901   ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA

    961   ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC

    1021  GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG

    1081  CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG

    1141  CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT

    1201  GCGCATGATCGTGCTAGCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTT

    1281  AGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTG  CTGCTGCAAAACGTCTGCGA

    1341  AACATGAATGGTCTTCGGTTTCCGTGTTTC     GTAAAGTCTGGAAACGCGGAAGTCAGCGCC

    "And here is the revised DNA strand, repaired by the computer. The operation you've witnessed would have taken months in a conventional lab, but we can do it in seconds."

    "Then are you working with the entire DNA strand?" Grant asked.

    "Oh no," Wu said. "That's impossible. We've come a long way from the sixties, when it took a whole laboratory four years to decode a screen like this. Now the computers can do it in a couple of hours. But, even so, the DNA molecule is too big. We look only at the sections of the strand that differ from animal to animal, or from contemporary DNA. Only a few percent of the nucleotides differ from one species to the next. That's what we analyze, and it's still a big job."

    Dennis Nedry yawned. He'd long ago concluded that InGen must be doing something like this. A couple of years earlier, when InGen had hired Nedry to design the park control systems, one of the initial design parameters called for data records with 3 X 109 fields. Nedry just assumed that was a mistake, and had called Palo Alto to verify it. But they had told him the Spec was correct. Three billion fields.

    Nedry had worked on a lot of large systems. He'd made a name for himself setting up worldwide telephone communications for multinational corporations. Often those systems had millions of records. He was used to that. But InGen wanted something so much larger. . . .

    Puzzled, Nedry had gone to see Barney Fellows over at Symbolics, near the M.I.T. campus in Cambridge. "What kind of a database has three billion records, Barney?"

    "A mistake," Barney said, laughing. "They put in an extra zero or two."

    "It's not a mistake. I checked. It's what they want."
    "But that's crazy," Barney said. "It's not workable. Even if you had the fastest processors and blindingly fast algorithms, a search would still take days. Maybe weeks."

    "Yeah," Nedry said. "I know. Fortunately I'm not being asked to do algorithms. I'm just being asked to reserve storage and memory for the overall system. But still . . . what could the database be for?"

    Barney frowned. "You operating under an ND?"

    "Yes," Nedry said. Most of his jobs required nondisclosure agreements.

    "Can you tell me anything?"

    "It's a bioengineering firm."

    "Bioengineering," Barney said. "Well, there's the obvious. . . ."

    "Which is?"

    "A DNA molecule."

    "Oh, come on," Nedry said. "Nobody could be analyzing a DNA molecule." He knew biologists were talking about the Human Genome Project, to analyze a complete human DNA strand. But that would take ten years of coordinated effort, involving laboratories around the world. It was an enormous undertaking, as big as the Manhattan Project, which made the atomic bomb. "This is a private company," Nedry said.

    "With three billion records," Barney said. "I don't know what else it could be. Maybe they're being optimistic designing their system."

    "Very optimistic," Nedry said.

    "Or maybe they're just analyzing DNA fragments, but they've got RAM-intensive algorithms."

    That made more sense. Certain database search techniques ate up a lot of memory.

    "You know who did their algorithms?"

    "No," Nedry said. "This company is very secretive."

    "Well, my guess is they're doing something with DNA," Barney said. "What's the system?"

    "Multi-XMP."

    "Multi-XMP? You mean more than one Cray? Wow." Barney was frowning, now, thinking that one over. "Can you tell me anything else?"

    "Sorry," Nedry said. "I can't." And he had gone back and designed the control systems. It had taken him and his programming team more than a year, and it was especially difficult because the company wouldn't ever tell him what the subsystems were for. The instructions were simply "Design a module for record keeping" or "Design a module for visual display." They gave him design parameters, but no details about use. He had been working in the dark. And now that the system was up and running, he wasn't surprised to learn there were bugs. What did they expect? And they'd ordered him down here in a panic, all hot and bothered about "his" bugs. It was annoying, Nedry thought.

    Nedry turned back to the group as Grant asked, "And once the computer has analyzed the DNA, how do you know what animal it encodes?"

    "We have two procedures," Wu said. "The first is phylogenetic mapping. DNA evolves over time, like everything else in an organism-hands or feet or any other physical attribute. So we can take an unknown piece of DNA and determine roughly, by computer, where it fits in the evolutionary sequence. It's time-consuming, but it can be done."

    "And the other way?"

    Wu shrugged. "Just grow it and find out what it is," he said. "That's what we usually do. I'll show you how that's accomplished."

    Tim felt a growing impatience as the tour continued. He liked technical things, but, even so, he was losing interest. They came to the next door, which was marked FERTLIZATION, Dr. Wu unlocked the door with his security card, and they went inside.

    Tim saw still another room with technicians working at microscopes. In the back was a section entirely lit by blue ultraviolet light. Dr. Wu explained that their DNA work required the interruption of cellular mitosis at precise instants, and therefore they kept some of the most virulent poisons in the world, "Helotoxins, colchicinolds, beta-alkaloids," he said, pointing to a series of syringes set out under the UV light. "Kill any living animal within a second or two."

    Tim would have liked to know more about the poisons, but Dr. Wu droned on about using unfertilized crocodile ova and replacing the DNA; and then Professor Grant asked some complicated questions. To one side of the room were big tanks marked LIQUID N2. And there were big walk-in freezers with shelves of frozen embryos, each stored in a tiny silver-foil wrapper.

    Lex was bored. Nedry was yawning. And even Dr. Sattler was losing interest. Tim was tired of looking at these complicated laboratories. He wanted to see the dinosaurs.

    The next room was labeled HATCHERY. "It's a little warm and damp in here," Dr. Wu said. "We keep it at ninety-nine degrees Fahrenheit and a relative humidity of one hundred percent. We also run a higher O2 concentration. It's up to thirty-three percent."

    "Jurassic atmosphere," Grant said.

    "Yes. At least we presume so. If any of you feel faint, just tell me."

    Dr. Wu inserted his security card into the slot, and the outer door hissed open. "Just a reminder: don't touch anything in this room. Some of the eggs are permeable to skin oils. And watch your heads. The sensors are always moving."

    He opened the inner door to the nursery, and they went inside. Tim faced a vast open room, bathed in deep infrared light. The eggs lay on long tables, their pale outlines obscured by the hissing low mist that covered the tables. The eggs were all moving gently, rocking.

    "Reptile eggs contain large amounts of yolk but no water at all. The embryos must extract water from the surrounding environment. Hence the mist,"

    Dr. Wu explained that each table contained 150 eggs, and represented a new batch of DNA extractions. The batches were identified by numbers at each table: STEC-458/2 or TRIC-390/4. Waist-deep in the mist, the workers in the nursery moved from one egg to the next, plunging their hands into the mist, turning the eggs every hour, and checking the temperatures with thermal sensors. The room was monitored by overhead TV cameras and motion sensors. An overhead thermal sensor moved from one egg to the next, touching each with a flexible wand, beeping, then going on.

    "In this hatchery, we have produced more than a dozen crops of extractions, giving us a total of two hundred thirty-eight live animals. Our survival rate is somewhere around point four percent, and we naturally want to improve that. But by computer analysis we're working with something like five hundred variables: one hundred and twenty environmental, another two hundred intra-egg, and the rest from the genetic material itself. Our eggs are plastic. The embryos are mechanically inserted, and then hatched here."

    "And how long to grow?"

    "Dinosaurs mature rapidly, attaining full size in two to four years. So we now have a number of adult specimens in the park."

    "What do the numbers mean?"

    "Those codes," Wu said, "identify the various batch extractions of DNA. The first four letters identify the animals being grown. Over there, that TRIC means Triceratops. And the STEC means Stegosaurus, and so on.

    "And this table here?" Grant said.

    The code said XXXX-0001/1. Beneath was scrawled "Presumed Coelu."

    "That's a new batch of DNA," Wu said. "We don't know exactly what will grow out. The first time an extraction is done, we don't know for sure what the animal is. You can see it's marked 'Presumed Coelu,' so it is likely to be a coelurosaurus. A small herbivore, if I remember. It's hard for me to keep track of the names. There are something like three hundred genera of dinosaurs known so far."

    "Three hundred and forty-seven," Tim said.

    Grant smiled, then said, "Is anything hatching now?"

    "Not at the moment. The incubation period varies with each animal, but in general it runs about two months. We try to stagger hatchings, to make less work for the nursery staff. You can imagine how it is when we have a hundred and fifty animals born within a few days-though of course most don't survive. Actually, these X's are due any day now. Any other questions? No? Then we'll go to the nursery, where the newborns are."

    It was a circular room, all white. There were some incubators of the kind used in hospital nurseries, but they were empty at the moment. Rags and toys were scattered across the floor. A young woman in a white coat was seated on the floor, her back to them.

    "What've you got here today, Kathy?" Dr. Wu asked.

    "Not much," she said. "Just a baby raptor."

    "Let's have a look."

    The woman got to her feet and stepped aside. Tim heard Nedry say, "It looks like a lizard."

    The animal on the floor was about a foot and a half long, the size of a small monkey. It was dark yellow with brown stripes, like a tiger. It had a lizard's head and long snout, but it stood upright on strong hind legs, balanced by a thick straight tail. Its smaller front legs waved in the air. It cocked its head to one side and peered at the visitors staring down at it.

    "Velociraptor," Alan Grant said, in a low voice.

    "Velociraptor mongoliensis," Wu said, nodding. "A predator. This one's only six weeks old."

    " I just excavated a raptor," Grant said, as he bent down for a closer look. Immediately the little lizard sprang up, leaping over Grant's head into Tim's arms.

    "Hey!"

    "They can jump," Wu said. "The babies can jump. So can the adults, as a matter of fact."

    Tim caught the velociraptor and held it to him. The little animal didn't weigh very much, a pound or two. The skin was warm and completely dry. The little head was inches from Tim's face. Its dark, beady eyes stared at him. A small forked tongue flicked in and out.

    "Will he hurt me?"

    "No. She's friendly."

    "Are you sure about that?" asked Gennaro, with a look of concern.

    "Oh, quite sure," Wu said. "At least until she grows a little older. But, in any case, the babies don't have any teeth, even egg teeth."

    "Egg teeth?" Nedry said.

    "Most dinosaurs are born with egg teeth-little horns on the tip of the nose, like rhino horns, to help them break out of the eggs. But raptors aren't. They poke a hole in the eggs with their pointed snouts, and then the nursery staff has to help them out."
PrevPage ListNext